A-LevelBiologyGenetic technology9700/42 · Feb/Mar 2020 · Q510 Marks

To identify the function of a gene, scientists can insert (add) a copy of the gene into a plasmid to create recombinant DNA. The plasmid is then transferred into a host bacterium to express the gene.

(a)Define recombinant DNA.[1]
(b)One plasmid used by scientists for this purpose is pIRES2-EGFP. Fig. 5.1 shows the main features of pIRES2-EGFP. multiple cloning site (MCS) promoter region gene for antibiotic resistance gene coding for green fluorescent protein (GFP) [Figure 5.1] This plasmid includes a gene that codes for a fluorescent protein, GFP. Explain the purpose of including a gene for a fluorescent protein in the plasmid.[2]
(c)A gene with unknown function was inserted into the multiple cloning site (MCS) of pIRES2-EGFP. The MCS contains the target nucleotide sequence for a number of different restriction endonucleases. The nucleotide sequence of the MCS in pIRES2-EGFP is shown in Fig. 5.2. 5'CTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCC 3' 3'GAGTCTAGAGCTCGAGTTCGAAGCTTAAGACGTCAGCTGCCATGGCGCCCGGGCCCTAGG 5' [Figure 5.2] The nucleotide sequences targeted by six restriction endonucleases and the way in which these enzymes cut DNA are shown in Fig. 5.3. [Figure 5.3] Describe the type of end produced when DNA is cut using the restriction endonuclease SmaI.[1]
(d)(i)Scientists used two of the restriction endonucleases shown in Fig. 5.3 to obtain the gene with unknown function for inserting into the MCS of pIRES2-EGFP. Fig. 5.4 shows the gene obtained after cutting with these two restriction endonucleases, including the nucleotide sequences of the two ends. The DNA START codon, ATG, and DNA STOP codon, TAA, are shaded. 5'TCGAGATG TAAG 3' DNA sequence of gene 3' CTAC ATTCAGCT 5' [Figure 5.4] Name the two restriction endonucleases in Fig. 5.3 that were used to cut the MCS of pIRES2-EGFP so that the gene shown in Fig. 5.4 could be inserted. The nucleotide sequence of the MCS in pIRES2-EGFP is shown in Fig. 5.2.[2]
(d)(ii)On Fig. 5.2, draw around the group of nucleotides in the MCS that were removed to insert the gene shown in Fig. 5.4.[2]
(d)(iii)To identify the function of the gene, it is important that the gene can be easily inserted into the plasmid and, once inserted, that it is expressed. Suggest one reason why scientists used different restriction sites at the 5' end and 3' end of the gene for inserting the gene into the plasmid.[1]
(d)(iv)Name the enzyme used to join the cut ends of the gene to the cut ends of the plasmid.[1]

Mark scheme

Marking points from the official mark scheme (Feb/Mar 2020). The mark or mark type is shown in brackets.

[1] 5(a) DNA that contains genetic material from two different organisms / DNA from two different sources ;
[2] 5(b) any two from: 1 marker (gene); 2 to identify, transformed bacteria / bacteria that have taken up plasmid ; 3 detected, under UV light / because GFP fluoresces;
[1] 5(c) blunt / AW ; A not sticky
[2] 5(d)(i) XhoI; SalI;
[2] 5(d)(ii) 5' CTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCC 3' |--------| |------------------------------------------------------------------| |--------------------------| |----------------------------------------------------------------| 3' GAGTCTAGAGCTCGAGTTCGAAGCTTAAGACGTCAGCTGCCATGGCGCCCGGGCCCTAGG 5' L ;; one mark for each end
[1] 5(d)(iii) any one from: 1 to ensure the, start codon / ATG, of the gene is located next to the promoter or idea of correct (5' to 3') direction of gene in plasmid ; 2 to prevent the plasmid reannealing if the gene does not get inserted ; 3 to prevent the gene from, annealing / forming a circle; 4 idea of 2 different sticky ends on the inserted gene, so 2 different restriction sites used in plasmid ;
[1] 5(d)(iv) (DNA) ligase ;